Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16 #958

gxydevbot · 2025-09-29T05:16:21Z

Hello! This is an automated update of the following workflow: workflows/epigenetics/chipseq-pe. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1 should be updated to toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.4+galaxy0

The workflow release number has been updated from 0.15 to 0.16.

If you want to skip this change, close this PR without deleting the branch. It will be reopened if another change is detected.
Any commit from another author than 'planemo-autoupdate' will prevent more auto-updates.
To ignore manual changes and allow autoupdates, delete the branch.

github-actions · 2025-09-29T05:40:30Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ chipseq-pe.ga_0

Problems:

Output with path /tmp/tmpku4x4np3/mapping stats__dd7168b3-21f0-41f2-a691-6af9184c72c2.txt different than expected
Expected text '39329 (84.93%) aligned concordantly exactly 1 time' in output ('46307 reads; of these:
  46307 (100.00%) were paired; of these:
    1292 (2.79%) aligned concordantly 0 times
    41729 (90.11%) aligned concordantly exactly 1 time
    3286 (7.10%) aligned concordantly >1 times
    ----
    1292 pairs aligned concordantly 0 times; of these:
      259 (20.05%) aligned discordantly 1 time
    ----
    1033 pairs aligned 0 times concordantly or discordantly; of these:
      2066 mates make up the pairs; of these:
        1220 (59.05%) aligned 0 times
        506 (24.49%) aligned exactly 1 time
        340 (16.46%) aligned >1 times
98.68% overall alignment rate
')

Workflow invocation details

Invocation Messages

Steps

Step 1: PE fastq input:
- step_state: scheduled
Step 2: adapter_forward:
- step_state: scheduled

Step 11: summary of MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -P -A 0 -B 0 --no-group-separator  -i -- '^#' '/tmp/tmp2lydd88h/files/d/7/f/dataset_d7fd3958-adf9-46a8-aaf3-5963fa800404.dat' > '/tmp/tmp2lydd88h/job_working_directory/000/7/outputs/dataset_b5b84b85-a7a1-4238-b74e-6b059fbc2d3e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"b85ee6a09cf511f099ef7ced8d70aedb"`
case_sensitive	`"-i"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
color	`"NOCOLOR"`
dbkey	`"mm10"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-P"`
url_paste	`"^#"`

Step 12: Bigwig from MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -v "^track" '/tmp/tmp2lydd88h/files/8/1/f/dataset_81f9e598-eae4-4e84-9e23-5b1978c911d7.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len' '/tmp/tmp2lydd88h/job_working_directory/000/8/outputs/dataset_59818ac7-5092-4b62-879a-0577ab5de932.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bedgraph"`
__workflow_invocation_uuid__	`"b85ee6a09cf511f099ef7ced8d70aedb"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
dbkey	`"mm10"`
settings	`{"__current_case__": 0, "settingsType": "preset"}`

Step 13: MultiQC:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmp2lydd88h/files/d/f/6/dataset_df6b94e0-fbdb-47da-a4b4-4a769e8d91b6.dat' 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&  mkdir multiqc_WDir/bowtie2_1 &&         grep -Pq '% overall alignment rate' /tmp/tmp2lydd88h/files/d/d/7/dataset_dd7168b3-21f0-41f2-a691-6af9184c72c2.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmp2lydd88h/files/d/d/7/dataset_dd7168b3-21f0-41f2-a691-6af9184c72c2.dat' 'multiqc_WDir/bowtie2_1/wt_H3K4me3'  &&    mkdir multiqc_WDir/macs2_2 &&    grep -q "# This file is generated by MACS" /tmp/tmp2lydd88h/files/d/7/f/dataset_d7fd3958-adf9-46a8-aaf3-5963fa800404.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmp2lydd88h/files/d/7/f/dataset_d7fd3958-adf9-46a8-aaf3-5963fa800404.dat' 'multiqc_WDir/macs2_2/wt_H3K4me3_peaks.xls' &&   multiqc multiqc_WDir --filename 'report'    --export   && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.27

     version_check | MultiQC Version v1.31 now available!
       file_search | Search path: /tmp/tmp2lydd88h/job_working_directory/000/9/working/multiqc_WDir

             macs2 | Found 1 logs
           bowtie2 | Found 1 reports
          cutadapt | Found 1 reports
     write_results | Rendering plots. Export plots to formats png, svg, pdf is requested, so it might take a while. To disable plot export, set `export_plots: false` in config, or remove the `--export-plots` command line flag

     write_results | Data        : report_data
     write_results | Report      : report.html
     write_results | Plots       : report_plots
           multiqc | MultiQC complete

Standard Output:

total 132
-rw-r--r-- 1 1001 1001   199 Sep 29 05:39 bowtie2_pe_plot.txt
-rw-r--r-- 1 1001 1001    81 Sep 29 05:39 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 1001   549 Sep 29 05:39 cutadapt_trimmed_sequences_plot_3_Counts.txt
-rw-r--r-- 1 1001 1001   727 Sep 29 05:39 cutadapt_trimmed_sequences_plot_3_Obs_Exp.txt
-rw-r--r-- 1 1001 1001   894 Sep 29 05:39 multiqc.log
-rw-r--r-- 1 1001 1001   393 Sep 29 05:39 multiqc_bowtie2.txt
-rw-r--r-- 1 1001 1001   425 Sep 29 05:39 multiqc_citations.txt
-rw-r--r-- 1 1001 1001   242 Sep 29 05:39 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 1001 84040 Sep 29 05:39 multiqc_data.json
-rw-r--r-- 1 1001 1001   176 Sep 29 05:39 multiqc_general_stats.txt
-rw-r--r-- 1 1001 1001   196 Sep 29 05:39 multiqc_macs.txt
-rw-r--r-- 1 1001 1001    51 Sep 29 05:39 multiqc_software_versions.txt
-rw-r--r-- 1 1001 1001   417 Sep 29 05:39 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"b85ee6a09cf511f099ef7ced8d70aedb"`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
comment	`""`
dbkey	`"mm10"`
export	`true`
flat	`false`
image_content_input	`None`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 7, "src": "hdca"}]}, "software": "macs2"}}]`
saveLog	`"false"`
title	`""`

Step 3: adapter_reverse:
- step_state: scheduled
Step 4: reference_genome:
- step_state: scheduled
Step 5: effective_genome_size:
- step_state: scheduled
Step 6: normalize_profile:
- step_state: scheduled

Step 7: Cutadapt (remove adapter + bad quality bases):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmp2lydd88h/files/4/d/0/dataset_4d0dd30d-83cd-4cba-a6a3-53e605cfbca6.dat' 'wt_H3K4me3_1.fq.gz' && ln -f -s '/tmp/tmp2lydd88h/files/9/1/2/dataset_912d2e8b-bdf2-4ac8-a8b1-8d9465d418f7.dat' 'wt_H3K4me3_2.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -a 'Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC '='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'    -A 'Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'='GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'    --error-rate=0.1 --times=1 --overlap=3    --action=trim   --quality-cutoff=30       --minimum-length=15      -o 'out1.fq.gz' -p 'out2.fq.gz'  'wt_H3K4me3_1.fq.gz' 'wt_H3K4me3_2.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"b85ee6a09cf511f099ef7ced8d70aedb"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}`
chromInfo	`"/tmp/tmp2lydd88h/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "15", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_name": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", "adapter_name": "Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["report"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 8: Bowtie2 map on reference:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmp2lydd88h/files/d/3/b/dataset_d3b16a56-efe1-41b1-aef8-baa5bc410cb6.dat' input_f.fastq.gz &&  ln -f -s '/tmp/tmp2lydd88h/files/b/0/c/dataset_b0cc7e2d-b05f-4048-ab23-55e0bbd3700c.dat' input_r.fastq.gz &&   THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x '/cvmfs/data.galaxyproject.org/byhand/mm10/bowtie2_index/mm10'   -1 'input_f.fastq.gz' -2 'input_r.fastq.gz'                2> >(tee '/tmp/tmp2lydd88h/job_working_directory/000/4/outputs/dataset_dd7168b3-21f0-41f2-a691-6af9184c72c2.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmp2lydd88h/job_working_directory/000/4/outputs/dataset_e5320059-c465-4b99-8320-22a0514837cd.dat'

Exit Code:

```
0
```

Standard Error:

46307 reads; of these:
  46307 (100.00%) were paired; of these:
    1292 (2.79%) aligned concordantly 0 times
    41729 (90.11%) aligned concordantly exactly 1 time
    3286 (7.10%) aligned concordantly >1 times
    ----
    1292 pairs aligned concordantly 0 times; of these:
      259 (20.05%) aligned discordantly 1 time
    ----
    1033 pairs aligned 0 times concordantly or discordantly; of these:
      2066 mates make up the pairs; of these:
        1220 (59.05%) aligned 0 times
        506 (24.49%) aligned exactly 1 time
        340 (16.46%) aligned >1 times
98.68% overall alignment rate

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__job_resource	`{"__current_case__": 0, "__job_resource__select": "no"}`
__workflow_invocation_uuid__	`"b85ee6a09cf511f099ef7ced8d70aedb"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "simple", "presets": "no_presets"}`
chromInfo	`"/tmp/tmp2lydd88h/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
library	`{"__current_case__": 1, "aligned_file": false, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "paired_options": {"__current_case__": 1, "paired_options_selector": "no"}, "type": "paired_collection", "unaligned_file": false}`
reference_genome	`{"__current_case__": 0, "index": "mm10", "source": "indexed"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`
sam_options	`{"__current_case__": 1, "sam_options_selector": "no"}`
save_mapping_stats	`true`

Step 9: filter MAPQ30 concordent pairs:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp2lydd88h/files/e/5/3/dataset_e5320059-c465-4b99-8320-22a0514837cd.dat' input.bam && ln -s '/tmp/tmp2lydd88h/files/_metadata_files/3/f/0/metadata_3f085edd-21d1-47c9-abe7-6ec633a46821.dat' input.bai && samtools view -o '/tmp/tmp2lydd88h/job_working_directory/000/5/outputs/dataset_2e9eedea-4071-44a5-a16d-d3b9a9dd52cb.dat' -h   -b  -q 30 -f 0x2 input.bam

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"b85ee6a09cf511f099ef7ced8d70aedb"`
bed_file	`None`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
dbkey	`"mm10"`
flag	`{"__current_case__": 1, "filter": "yes", "reqBits": ["0x0002"], "skipBits": null}`
header	`"-h"`
library	`""`
mapq	`"30"`
outputtype	`"bam"`
possibly_select_inverse	`false`
read_group	`""`
regions	`""`

Step 10: Call Peaks with MACS2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmp2lydd88h/files/2/e/9/dataset_2e9eedea-4071-44a5-a16d-d3b9a9dd52cb.dat'  --name wt_H3K4me3    --format BAMPE   --gsize '1870000000'      --SPMR     --call-summits  --keep-dup '1'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --mfold '5' '50'  --bw '300'  2>&1 > macs2_stderr) && cp wt_H3K4me3_peaks.xls '/tmp/tmp2lydd88h/job_working_directory/000/6/outputs/dataset_d7fd3958-adf9-46a8-aaf3-5963fa800404.dat'   && ( count=`ls -1 wt_H3K4me3* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmp2lydd88h/job_working_directory/000/6/outputs/dataset_310b1582-d922-4ee4-b8ed-e1a5b3552f4b_files' && cp -r wt_H3K4me3* '/tmp/tmp2lydd88h/job_working_directory/000/6/outputs/dataset_310b1582-d922-4ee4-b8ed-e1a5b3552f4b_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmp2lydd88h/job_working_directory/000/6/outputs/dataset_310b1582-d922-4ee4-b8ed-e1a5b3552f4b_files' macs2_stderr > '/tmp/tmp2lydd88h/job_working_directory/000/6/outputs/dataset_310b1582-d922-4ee4-b8ed-e1a5b3552f4b.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)

Exit Code:

```
0
```

Standard Output:

INFO  @ Mon, 29 Sep 2025 05:38:17: 
# Command line: callpeak -t /tmp/tmp2lydd88h/files/2/e/9/dataset_2e9eedea-4071-44a5-a16d-d3b9a9dd52cb.dat --name wt_H3K4me3 --format BAMPE --gsize 1870000000 --SPMR --call-summits --keep-dup 1 --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --mfold 5 50 --bw 300
# ARGUMENTS LIST:
# name = wt_H3K4me3
# format = BAMPE
# ChIP-seq file = ['/tmp/tmp2lydd88h/files/2/e/9/dataset_2e9eedea-4071-44a5-a16d-d3b9a9dd52cb.dat']
# control file = None
# effective genome size = 1.87e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is on
# Searching for subpeak summits is on
# MACS will save fragment pileup signal per million reads
 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1 read fragment files... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1 read treatment fragments... 
INFO  @ Mon, 29 Sep 2025 05:38:17: 41724 fragments have been read. 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1 mean fragment size is determined as 201.8 bp from treatment 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1 fragment size = 201.8 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1  total fragments in treatment: 41724 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1 user defined the maximum fragments... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1 filter out redundant fragments by allowing at most 1 identical fragment(s) 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1  fragments after filtering in treatment: 41724 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1  Redundant rate of treatment: 0.00 
INFO  @ Mon, 29 Sep 2025 05:38:17: #1 finished! 
INFO  @ Mon, 29 Sep 2025 05:38:17: #2 Build Peak Model... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #2 Skipped... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3 Call peaks... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3 Going to call summits inside each peak ... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3 Pre-compute pvalue-qvalue table... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3 In the peak calling step, the following will be performed simultaneously: 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... wt_H3K4me3_treat_pileup.bdg 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3   Write bedGraph files for control lambda (after scaling if necessary)... wt_H3K4me3_control_lambda.bdg 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3   --SPMR is requested, so pileup will be normalized by sequencing depth in million reads. 
INFO  @ Mon, 29 Sep 2025 05:38:17: #3 Call peaks for each chromosome... 
INFO  @ Mon, 29 Sep 2025 05:38:17: #4 Write output xls file... wt_H3K4me3_peaks.xls 
INFO  @ Mon, 29 Sep 2025 05:38:17: #4 Write peak in narrowPeak format file... wt_H3K4me3_peaks.narrowPeak 
INFO  @ Mon, 29 Sep 2025 05:38:17: #4 Write summits bed file... wt_H3K4me3_summits.bed 
INFO  @ Mon, 29 Sep 2025 05:38:17: Done!

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"b85ee6a09cf511f099ef7ced8d70aedb"`
advanced_options	`{"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 1, "keep_dup_options_selector": "1"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": true, "to_large": false}`
chromInfo	`"/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len"`
control	`{"__current_case__": 1, "c_select": "No"}`
cutoff_options	`{"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"}`
dbkey	`"mm10"`
effective_genome_size_options	`{"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "1870000000"}`
format	`"BAMPE"`
nomodel_type	`{"__current_case__": 0, "band_width": "300", "mfold_lower": "5", "mfold_upper": "50", "nomodel_type_selector": "create_model"}`
outputs	`["peaks_tabular", "summits", "bdg", "html"]`
treatment	`{"__current_case__": 0, "input_treatment_file": {"values": [{"id": 10, "src": "dce"}]}, "t_multi_select": "No"}`

Other invocation details
- history_id
  - 669716743d29f56f
- history_state
  - ok
- invocation_id
  - 669716743d29f56f
- invocation_state
  - scheduled
- workflow_id
  - 669716743d29f56f

lldelisle · 2025-10-03T12:33:56Z

See #963

gxydevbot · 2025-10-13T06:01:01Z

There are new updates, they have been integrated to the PR, check the file diff.

gxydevbot · 2025-11-03T05:43:04Z

There are new updates, they have been integrated to the PR, check the file diff.

Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16

7a0aff8

lldelisle closed this Oct 3, 2025

gxydevbot changed the title ~~Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16~~ Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16 Oct 13, 2025

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Uh oh!

Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16 #958

Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16 #958

Uh oh!

gxydevbot commented Sep 29, 2025

Uh oh!

github-actions bot commented Sep 29, 2025

Workflow invocation details

Uh oh!

lldelisle commented Oct 3, 2025

Uh oh!

gxydevbot commented Oct 13, 2025

Uh oh!

gxydevbot commented Nov 3, 2025

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

2 participants

Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16 #958

Updating workflows/epigenetics/chipseq-pe from 0.15 to 0.16 #958

Uh oh!

Conversation

gxydevbot commented Sep 29, 2025

Uh oh!

github-actions bot commented Sep 29, 2025

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

lldelisle commented Oct 3, 2025

Uh oh!

gxydevbot commented Oct 13, 2025

Uh oh!

gxydevbot commented Nov 3, 2025

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

2 participants